Introduction:
While humans have 23 chromosome pairs, chimpanzees and other great apes have 24. A popular theory for this difference between us and our closest relatives is that, when we broke away from the shared ape ancestor, chromosomes 2a and 2b fused into one. There is a rather convincing amount of evidence for this hypothesis; however, there also exists a fair amount of evidence that brings this hypothesis into question. Dr. Jeffrey Tomkins, from the Institute for Creation Research, believes that the evidence against the chromosome fusion is conclusive. He asserts that there is far too much variation between how we would expect our fused chromosome 2 to look, and how it actually looks. Dr. Tomkins believes that this is evidence that humans and other great apes were genetically distinct since creation and did not evolve from a common ancestor.
Claims:
Dr. Tomkins’ main claim is that the chromosomal fusion of ape chromosomes 2A and 2B is scientifically impossible. He states that:
“The alleged fusion sequence contained a different signature, a telomere-telomere fusion, and, if real, would be the first documented case ever seen in nature.”
This was cited in his 2011 paper “Telomeres: Implications for aging and evidence for intelligent design” in the Journal of Creation. However, this is not a secular peer-reviewed journal, and cannot be considered a credible source.
“The research also showed that the genes surrounding the fusion site in the 614,000-base window did not exist on chimp chromosomes 2A or 2B.”
Tomkins cites two papers by Fan et al. These articles discuss the “lack of sytenty” that Tomkins writes about.
“Furthermore, the alleged fusion sequence contains a functional genetic feature called a ‘transcription factor binding site’.”
Tompkins gathers this data from the ENCODE project and the UCSC Genome Browser.
“Functional genes like DDX11L2 do not arise by the mythical fusing of telomeres. The alleged fusion site is not a degenerate fusion sequence but is and, since creation, has been a functional feature in an important gene.”
This quote summarizes Tompkins’ argument- that since a chromosomal fusion is unlikely, it must have been created by intelligent design. Dr. Tompkins offers no proof for intelligent design.
Our Research:
We started our search for chromosome two fusion site with the gene research. By assuming that chromosomes 2A and 2B join end-to-end at their telomeres, we believe that the genes at the proximity to the telomeres are still preserved in humans after fusion. These genes also served as the boundaries for telomeric region search. Based on our assumptions, we found that PAX8 was the last gene on chromosome 2A which was still preserved on chromosome 2 of humans. However, there were several other genes that were located after PAX8 on chromosome 2A that were homologous to genes on other human chromosomes, such as FOXD4 was found on chromosome 9 of humans rather than 2. Nonetheless, we found a similar gene, FOXD4L1, close to the region of fusion site on human chromosome 2. We suspected that this FOXD4L1 was indeed similar to FOXD4 on chromosome 2A, making it the last gene on chromosome 2A before the fusion site.
Based on the analysis of first gene on chromosome 2B (RABL2A) and last gene on chromosome 2A (FOXD4L1), we came up with the region of fusion between 113.4 Mb to 113.7 Mb. In this 300kb region, we found the DDX11L2 gene (113599036-113601261) that was mentioned as a fusion site in Tomkins’ argument. Within this 2.23kb region, there is only one monomer of TTAGGG, making it part of telomeric region unlikely. Overall in the region between 113.4Mb and 113.7Mb, there were only 81 matching TTAGGG sequences. These sequences scattered throughout the region, and were not continuously repeated as expected. Because Tomkins did not state how his analysis showed the fusion site at DDX11L2, we had no way to verify it. However, we knew that if fusion site existed there, this region should be filled with TTAGGG sequences, regardless of being monomeric throughout the region or not. Additionally, NCBI sources state that DDX11L2 is a pseudogene and does not have a known function. This gene was not found in Chimpanzee, indicating that DDX11L2 could either be a product of fusion or a gene unique to humans which refuted our common ancestry with Chimpanzees. Regardless of whether DDX11L2 is unique to humans or not, we can only say that Tomkins argument is not supported by other sources.
Continuing with the analysis of chromosome 2B of Pan. troglodytes, the region from 1 to 114.1Mb did not contain any coding gene. The region between last gene of 2A and first gene of 2B was only about 300kb. The missing millions of base pair from chromosome 2B of Pan. Troglodytes did not support the theory of fusion. This finding neither supports nor refute Tomkins’ argument against fusion theory. In fact, it does not provide evidence to support any fusion theory.
Lastly, we decided to do some sequence alignment to see how similar the end of chromosome 2A and the beginning of chromosome 2B are to the postulated fusion site on chromosome 2. The sequences we used were 2A: 113300000-113622374; 2B: 114000000-115000000; and Humans Chr2:112000000-114881943. The sequence for chromosome 2B is not at the beginning because NCBI database did not provide any useful nucleotide sequences, except NNNNN. We chose to start with actual ACTG sequence at 114000000. Using Muscle tool (http://www.drive5.com/muscle.downloads.htm) to align the sequences, we expected to see chromosome 2A and 2B align with chromosome 2 in humans in that order. However, the system failed to align any sequences. This could be due to error combining the sequences or could be that these ends did not fuse. There was no telomeric sequences in this region of chromosome 2 as expected. Again, this method neither supports nor argue against Tomkins or any other theories, it simply states that the possibility of fusion may not be as strong as we think.
DDX11L2 nucleotide sequence (Homo sapiens)
AACCAACAGTGTGCTTTTAATAAAGGACCTCTAGCTGTGCAGGATGCAAACGTCTCGGGGTCAG
TGACTGCCTCCTGCCCCTGTTGGTCCCTAGGCAGTGGGGGCAGAAGCTCCCAGCTGACCTGTTTC
TCTGGGATGAGAGGGAGGAGAGAAGGGCAGTTAGCAGGGGCAGCTGTTGCAGATGGGAGGAAT
AGTCTCCCACAAAAAAGGTTTCAGTGACAGACACGGGGTCTCTAAAAATAGTCATGCTGAGAGC
CTAATGGCCCTTGGCACAATTGCTGGTGTTGGGGTAGAAGATGTCTTGGAGTTTGCTCAAGTGGT
TGAGAGGGAGGGAGGTGCCATCGACTTGGAGGAACTGGCACCAAGCCAGGGAGATAGACATCC
AGGCAAGGCTGTGGGGCAGGTTAGGGAGCAAGGCTGCAGGAGTGACTCAGGAAGAAGGTGGG
GGAGGTGACAAGCCCCCAGGCAGGGGCCCTGTGGCCATGGGGATCTTTTTAAATTGAGACTAGG
GGGTGAATAGTCCAGGGCAGCTAACTTTAGTTATTATAGAAAGGGCAGTAGCAGATGGGTCTGC
TCCGTCTCGCTTCTAAGAAGGTGGGCAGGACAAATGGCAGCCTCCTGCAGAGGCCTAGTGAGAA
GCCTGGCCCTCGGCCACACAGGATGGAAGACAGATTGGGTTCCACAGAGGGGAGCTGCCCTGG
GAAGATCTCACGGATGGCCAGGACCCACCATTTCTTTGGGATTCCCGTTTTCTCCAACGGGCACT
AATGCCTGTGCCTGGGTCCTGGCAACACTCTGGACTCCACACTCTCCTGGGTTTCACCTTTGTAG
CAGGATCCCTGCAGACCAGGCCCATGACAAACACCGTCTCCAGCGGGCAGAGCAAAGGAAGGG
CACAGCGCCAGGCAGTGGTGCAGCTGCCTGTCAGGATGAGGCCTACTTCTAGTGAAACTGGGCA
GACAAAAGGCAGTGAGAAATGTGATCTCGGGGTGGTGGAGGCTCTAGGGAAAGGAAAAGGCAG
GAGTGAACTTCCACACAGCAGCAATGGCAGAACCAAAGGTGGCTTTGACCTCCACGAGGGCTCA
GATCCAGGCCAACAGCTTGTCCAGGACAGGGTGCCGGGTGTATCACTGGTCCAGGAGCACTATG
CTGGCAGAATCCCTTTGGTGCCTGATGGCCCTGCCTTCGTGGGAACAGAGGCTAAGGCTTTGAGT
TACAGCTGCCTCCCCAACAGTGCATCCCCTTCTCCCTCCTCAGCCTCAGGTAGGAGACAGGGCAG
GCAACCCCCTTTCCTCTTCTCCCCTTCTCCAGCCCCTGTCTGTCCACCCAGCTGGAGGCAGCCAG
GCTTGCCTATGGACTGGTTGACAGCCTTCATGCAGAGGTTCTCCACCAGAGCCTTTCTTGGGGGC
CCCTGGCCTGGGCTCTGAGCTGGGAGTGAAGGGGATGACCCATGCGGACTGTTTGCTGCTTGTA
GCTTTCCCTGGGAAAGACTCTGCCAGGCCTTGGAGCCAGACCAGGAGGCTTTATAAGGCCACCG
CAAGCAGCAGGGCTCCAGATGACATCACAGGGAAGATCAAGAGGGTGTGGAGGGGCATCGAAG
CCTCTCCAGAGACAGGAGACGCTGGTCCAGTAGAGCCCTAGGGGCGACGCCACTCCCACTCACT
GTCTACTCTCCTCTCACCTCTGCAACACTGGGGACACTCACAAGAGTGTGATCCAAGTCGGCCGT
CGTCTTCTGCAGCTCTGGAGACCTGATGCTAGGGAAGGGCATGCCTGGCATCACCACACACCTG
GGGGGAGACAGGAGCCTGGGGCCGGTGGGCCCACACATCACCAGCTGCTCCGTTCTACCATTTC
TTCAGCCCTCTTGGCTGTGCCTGCAGCTCTGCCCCTCCCCTCTCTGCACCTACCACCCAGAGAGG
GCTTGTTGAGCTCAGAGATCCCACCTAGGCCAATCCACTGGGTTCTGCGGCAGCGATGGCCTGC
CTGATCTTCCACCTGCTCTCCCAGGGCCAAAGCCAGACCTGCTGAGCCCCTCCCTCCAGCCGGCT
GGTCTGAGCAGTCACAGCCCGGCTTTGGGCTCCGATGGCAGCAGACGGCAGGTAGGGGTCCAG
CTGCTGGAGCGAGGGCCGGCCACCTATCACAGCCAAGGAGATGAGCACAAGCACTACTTACTGG
CCTAGGTTGTCAGAGAAGTTGATGCTCTCACTCATCTTTCCTCCAAT
Conclusion:
The fusion area from chimpanzee’s chromosomes 2A and 2B to human’s chromosome 2 is a telomere-telomere fusion. This differs from all other known fusion sequences, which are either satDNA-satDNA or satDNA-telomereDNA. Tomkins claims that the fusion site’s location is within the DDX11L2 gene on the human chromosome 2. However, our research does not support this. Tomkins doesn’t include that chromosome 2A and 2B contains very similar genes to chromosome 2 of humans. He also doesn’t mention the vestigal centromere protein located in human chromosome 2. Tomkins claims that the chromosomes are not an exact match, but for evolution to occur there must be mutation. He is forgetting the basic principle of natural selection- that if a mutation results in an increase in fitness of an organism, then that mutation may be passed on. It’s possible that a chromosomal fusion increases fitness in humans. Given the breadth of the evidence to date, it is extremely unlikely that the fusion of the chromosomes is false.
Works Cited:
“Chromosome 2 Fusion?” Evolution. Web. 15 Feb. 2016.
Fan, Y., E. Linardopoulou, C. Friedman, E. Williams, and B. J. Trask. 2002a. Genomic structure and evolution of the ancestral chromosome fusion site in 2q13-2q14.1 and paralogous regions on other human chromosomes. Genome Research 12, no. 11:1651–1662.
Fan, Y., T. Newman, E. Linardopoulou, and B. J. Trask. 2002b. Gene content and function of the ancestral chromosome fusion site in human chromosome 2q13-2q14.1 and paralogous regions. Genome Research 12, no. 11:1663–1672.
Fusion. Web. 15 Feb. 2016.
“New Research Debunks Human Chromosome Fusion.” New Research Debunks Human Chromosome
Tomkins, J. 2013. Alleged Human Chromosome 2 “Fusion Site” Encodes an Active DNA Binding Domain Inside a Complex and Highly Expressed Gene—Negating Fusion.Answers Research Journal. 6: 367-375.
cs4160 